XA21-mediated resistance to Xanthomonas oryzae pv. oryzae is dose dependent

Rice lines used

Two rice lines used as the resistant controls are KitaakeX and XA21c4300. KitaakeX is a Kitaake rice line expressing an XA21 transgene driven by the maize Ubi-1 promoter (Park et al., 2008; Jain et al., 2019). XA21c4300 is a Kitaake transgenic line carrying the 9.8-kb XA21 genomic fragment with its native promoter as originally reported (Song et al., 1995; Peng et al., 2008). The robust resistance of KitaakeX and XA21c4300 to the Xoo strain PXO99 has been documented (Peng et al., 2008; Park et al., 2008).

Plasmid construction and rice transformation

Two sub-regions of the XA21 genomic sequence were individually PCR-amplified and joined by a second round of PCR to generate the full-length HA-XA21 fragment carrying the coding sequence of the HA epitope tag. The fragment was sequentially inserted into the pCambia2300 vector backbone using restriction enzymes to generate the pCambia2300-HA-XA21 construct. The HA-XA21 insert was verified by PCR-sequencing. The rice cultivar Kitaake was used to generate the HA-XA21 transgenic plants. Agrobacterium-based rice transformation was performed as described previously (Hiei et al., 1994) with modifications. Rice calli were induced by incubating mature rice seeds on the MSD medium (MS with 2 mg/L 2,4-D) for 2-4 weeks at 28 °C under a 16-hour light/8-hour dark regime. Calli were transformed by co-cultivation with the culture of Agrobacterium strain EHA105 carrying the pCambia2300-HA-XA21 construct for 30 min. Excess bacterium culture was removed by drying the calli on a sterile filter paper, after which the calli were moved to co-cultivation medium (MSD with 5% sorbitol and 200 µM acetosyringone) and incubated at 25 °C in the dark for 3 days. From this stage on, calli were kept separately to avoid the repeated counting of the transformants. After co-cultivation, calli were moved to the selection medium MSDH50 (MS with 2 mg/L 2,4-D, and 50 mg/L hygromycin) and incubated for 4-6 weeks. During selection, actively dividing sections of the calli were removed and place on fresh medium every 2 weeks. Surviving calli were transferred to regeneration medium (MS with 0.5 mg/L NAA, 3 mg/L 6-BA, and 50 mg/L hygromycin) and cultured under the same condition for an additional 4-6 weeks. Regenerating plants (T0 generation) were moved to MS medium for rooting. The rooted T0 seedlings were subsequently transferred to sandy soil in pots and were grown in tubs filled with fertilized water in a glasshouse as described before (Pruitt et al., 2015).

DNA extraction and genotyping

For genotyping, a segment of the leaf blade was harvested from individual rice plants. DNA extraction from the harvested leaf tissue was performed using a standard CTAB-chloroform-based method. PCR genotyping was performed using the Dreamtaq system (Invitrogen, Carlsbad, CA, USA). The sequences of the primers used can be found in Table S2.

Whole-genome sequencing analysis

For whole-genome sequencing, leaf segments were harvested from all tillers of a single T0 transgenic plant and combined. DNA was isolated from the harvested leaf samples and was used for library construction. Sequencing reaction was performed using the HiSeq 2500 sequencing system (Illumina, San Diego, CA, USA) at the Joint Genome Institute following the manufacturer’s instructions. To identify the locations of the T-DNA inserts in the T0 transgenic events, all sequencing reads carrying the 20-nt “probe” sequence GATCAGATTGTCGTTTCCCG, which is located near the right border of the T-DNA, were identified. A BLAST analysis was performed on each of these reads using the Nipponbare reference genome to locate the rice genomic sequence adjacent to the probe sequence. The locations of the genomic sequences are used to map the right boundary of the T-DNA insertions. For each T0 individual, the number of reads supporting each distinct insertion site was calculated. Accession numbers of the resequencing data in this study at NIH’s Sequence Read Archive (SRA) can be found in Table S3.

SDS-PAGE and western blot analysis

Total protein was extracted by incubating homogenized leaf tissue with the extraction buffer (PBS pH 7.2 with 0.15 M NaCl, 2 mM EDTA, 1% Triton X-100, 1 mM PMSF, 20 mM NaF, and 0.068% beta-mercaptoethanol) on ice for 30 min. Samples were incubated at 95 °C for 5 min in SDS loading buffer to denature, and were subject to SDS-PAGE according to Bio-Rad’s standard protocol. Western blot was performed using a mouse anti-HA primary antibody (Sigma H3663, 1:500 dilution: Sigma, Burlington, MA, USA) and a mouse IgGκ light chain binding protein (m-IgGκ BP) conjugated to horseradish peroxidase (Santa Cruz SC-516102, 1:1000 dilution) as the secondary antibody. Enhanced chemiluminescent assay was performed with the SuperSignal West Femto Maximum Sensitivity Substrate (Thermo, Waltham, MA, USA) using the Bio-Rad Gel Doc system.

Rice growth conditions and inoculation assay

Rice plants were germinated in tap water at 28 °C for 14 days before transplanted to sandy soil in 5.5-inch square pots (three seedlings per pot). After transplanting, rice plants were grown in tubs filled with fertilizer water in a glasshouse. Five to six weeks after transplanting, when the rice plants reach the booting stage, they were transferred to a growth chamber set to 28 °C/24 °C, 80%/85% humidity, and 14/10-hour lighting for the day/night cycle. Xoo strain PXO99 was cultured on PSA plates at 28 °C. Bacteria from the plates were resuspended in sterile water at a density of 10⁸ cfu/mL and inoculated onto rice plants using the scissor clipping method as previously described (Kauffman et al., 1973).

Phenotypic analysis

Yield-related traits were quantified as previous reported with minor modifications (Zhou et al., 2023). Briefly, agronomical traits were assessed in ten-week-old homozygous T2/T3 plants under glasshouse conditions, including thousand-grain weight, grain length, grain width. Six randomly chosen plants were measured for each genotype. Statistical analysis was performed by using pairwise multiple comparison followed by Tukey’s test.

Generation of XA21 transgenic events in the rice cultivar Kitaake

We based our design of the XA21 transgene on the previously reported 9.9-kb XA21 genomic fragment carrying its native promoter and terminator (Song et al., 1995). To enable the quantification of the XA21 protein, nucleotide sequence encoding three consecutive HA epitope tags was placed in-frame with the XA21 coding sequence near its N-terminus, between Arg80 and Val81, within the leucine-rich repeats region (Fig. 1A). This recombinant XA21 protein carrying the 3xHA epitope tag (named HA-XA21) is likely to maintain its normal function, because a Myc epitope tag inserted at the same position does not to interfere with the function of XA21, which has been documented in a previous report (Park et al., 2008). The HA-XA21 transgene was introduced into the rice cultivar Kitaake through Agrobacterium-based transformation (Hiei et al., 1994). Among the 39 independent T0 transgenic events we generated, the HA-XA21 fusion protein was detected in the leaf tissue in 28 independent T0 plants by western blot (Fig. 1B), indicating that the HA-XA21 transgene is expressed in most of the regenerated events. Because all T0 transgenic events were genotypically validated to be XA21 transgene-positive, we reason that those events where HA-XA21 was undetectable through western blot failed to accumulate the protein to a high level.

Independent transformation events harbor various copies of HA-XA21 at distinct genomic sites

To precisely locate the T-DNA insertion sites in the twenty-eight T0 events expressing HA-XA21, whole-genome sequencing was performed using genomic DNA from the individual T0 plants. For each T0 plant, sequencing reads that contain a 20-nucleotide sequence on the T-DNA near the right border were isolated. We expected most of these reads to also carry rice genomic sequence adjacent to T-DNA right border. By mapping these reads back to the rice genome, we identified T-DNA insertion sites in sixteen T0 events (Table S1). Each of the insertion sites are located at distinct regions randomly distributed in the rice genome. Ten events carry single-site T-DNA insertions. Five events had two insertion sites each. One event, 11A, carries insertions at five distinct sites. The distribution of the T-DNA copy number among the events we obtained is consistent with previously reported trends in Agrobacterium-transformed rice plants (Yang et al., 2005).

The amount of the HA-XA21 protein correlates with the level of Xoo resistance

To obtain homozygous lines of single-site HA-XA21 transgenic events, we planted T1 progeny derived from the six T0 events that carry the T-DNA insert at a single site in the genome based on the whole genome sequencing analysis described above (Table S1; 15A, 19A, 25A, 33A, 39A, and 47A). We then self-pollinated these T1 progeny and harvested T2 seeds from the T1 individuals. Because each of the T-DNA inserts contains an nptII selectable marker gene, which confers resistance to the selection agent G418, if the T2 progeny from a single T1 parent all exhibits resistance when germinated in the presence of 50 mg/L G418, this result indicates that the T1 parent carries a homozygous single-site insertion. Using this approach, we identified the T1 individuals 15A-1, 19A-2, 25A-1, 33A-5, 39A-4, and 47A-3 as being homozygous for the T-DNA insertion. We further validated the homozygous inserts in these lines by PCR using primers designed to test the presence and homozygosity of the T-DNA inserts based on the identified insertion sites (Fig. S1).

To quantify the HA-XA21 protein level, we performed a western blot assay and found that the amount of HA-XA21 protein accumulation differed in each of the transgenic lines (Figs. 2A, 2B). We next performed a leaf inoculation assay on these lines using Xoo strain PXO99 and observed various levels of resistance in distinct HA-XA21 transgenic lines (Fig. 2C). The rice plants used for the western blot and the Xoo inoculation assay were raised in parallel and were at the same age when the tissue harvest or the inoculation took place. To further control the experiment, the leaf segments harvested for total protein extraction correspond to the clipping site used in the Xoo inoculation assay. This experimental design helped ensure the biologically relevance of the tissue used for HA-XA21 protein quantification. We observed a positive correlation between the level of the HA-XA21 protein and Xoo resistance across the six transgenic lines (Figs. 2B, 2C), suggesting a possible dosage effect of XA21-mediated defense in the Kitaake rice cultivar. In particular, transgenic lines T0-25A-1 and T0-39A accumulated significant levels of HA-XA21 protein and conferred high levels of resistance approaching that conferred by transgenic Kitaake lines expressing XA21 under the maize Ubi-1 promoter (KitaakeX) or the native XA21 promoter (XA21c4300), both of which have been previously characterized (Peng et al., 2008; Park et al., 2008). Notably, KitaakeX constitutively expresses XA21 to a high level and displayed the strongest resistance to PXO99 in our inoculation assay, which is consistent with the hypothesized dosage effect of XA21. To validate that the HA-XA21 transgene is responsible for the Xoo resistance observed, we performed a co-segregation assay using the T1 progeny from T0-45A (Fig. S2). Co-segregation of the resistance and the HA-XA21 transgene was observed, which indicates that the HA-XA21 transgene accounts for the observed resistance to Xoo.

All tested HA-XA21 lines display normal growth and development

To test whether the expression of HA-XA21 incurs any negative impact on the growth and development of the rice plants, we assessed the morphology of the rice plants and the panicles, and quantified several key yield-related traits including grain length, grain width, and 1000-grain weight of the six homozygous HA-XA21 transgenic lines (Fig. 3). We did not observe effects of the HA-XA21 transgene on plant stature, the size of the panicle, or the size and weight of the grains. These results indicate that XA21 expression in the transgenic lines we tested does not incur a yield penalty under our greenhouse conditions, making the corresponding insertion sites promising knock-in targets for engineered defense. For a more thorough analysis of agronomic traits of the above lines, field tests are needed.